ID: 1127433410_1127433421

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1127433410 1127433421
Species Human (GRCh38) Human (GRCh38)
Location 15:58933703-58933725 15:58933748-58933770
Sequence CCGCCACCCTAGCGCAACCTGCA TGACGGCCGCGCGTGCGCGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138} {0: 1, 1: 0, 2: 1, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!