ID: 1127433418_1127433427

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1127433418 1127433427
Species Human (GRCh38) Human (GRCh38)
Location 15:58933736-58933758 15:58933775-58933797
Sequence CCAGCACCCGGATGACGGCCGCG GGGACCGGCAGCGGCGCGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48} {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!