ID: 1127525935_1127525945

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1127525935 1127525945
Species Human (GRCh38) Human (GRCh38)
Location 15:59792115-59792137 15:59792131-59792153
Sequence CCCCCAGCCATTAGGCCCTCCCT CCTCCCTGGCCTTGAAGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 78, 3: 157, 4: 391} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!