ID: 1127586885_1127586888

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1127586885 1127586888
Species Human (GRCh38) Human (GRCh38)
Location 15:60386896-60386918 15:60386922-60386944
Sequence CCCCAAGAATAAAGAAAACAGAG AGCTGCGTCCTGAAATAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 82, 4: 946} {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!