ID: 1127658379_1127658386

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1127658379 1127658386
Species Human (GRCh38) Human (GRCh38)
Location 15:61076913-61076935 15:61076962-61076984
Sequence CCCTCTCCCTTGCTTGTTCAAAG TTCTTGAACTACACACAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 292} {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!