ID: 1127659639_1127659641

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1127659639 1127659641
Species Human (GRCh38) Human (GRCh38)
Location 15:61088347-61088369 15:61088394-61088416
Sequence CCTCTAAGTGTGTGTGCATGTGT AAGCCACAGCTGCAAGAAACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 26, 3: 262, 4: 2145} {0: 1, 1: 0, 2: 1, 3: 29, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!