ID: 1127763526_1127763528

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1127763526 1127763528
Species Human (GRCh38) Human (GRCh38)
Location 15:62164273-62164295 15:62164287-62164309
Sequence CCAGGCGCTCAGGAAGCGGGGCC AGCGGGGCCCTGGATGACAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 214} {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!