ID: 1127808315_1127808317

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1127808315 1127808317
Species Human (GRCh38) Human (GRCh38)
Location 15:62541352-62541374 15:62541369-62541391
Sequence CCTTCCTCATTCTGTTATTTCTT TTTCTTGCTCTCGACTTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 120, 4: 1256} {0: 1, 1: 0, 2: 1, 3: 30, 4: 464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!