ID: 1127823304_1127823308

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1127823304 1127823308
Species Human (GRCh38) Human (GRCh38)
Location 15:62679941-62679963 15:62679987-62680009
Sequence CCTCCATCGAGTTACTTTTGCAT CATCTATATGGGTCTATTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 172} {0: 2, 1: 4, 2: 45, 3: 261, 4: 1006}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!