ID: 1127823305_1127823306

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1127823305 1127823306
Species Human (GRCh38) Human (GRCh38)
Location 15:62679944-62679966 15:62679975-62679997
Sequence CCATCGAGTTACTTTTGCATCAT TCTAGTTCAGCACATCTATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 159} {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!