ID: 1127827287_1127827291

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1127827287 1127827291
Species Human (GRCh38) Human (GRCh38)
Location 15:62715861-62715883 15:62715874-62715896
Sequence CCCTCTTCCCTCTGTCCCCACCT GTCCCCACCTGAGTTGATACTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 19, 3: 236, 4: 2049} {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!