ID: 1127827287_1127827300

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1127827287 1127827300
Species Human (GRCh38) Human (GRCh38)
Location 15:62715861-62715883 15:62715909-62715931
Sequence CCCTCTTCCCTCTGTCCCCACCT TCACATTTACCTGTGCCACAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 19, 3: 236, 4: 2049} {0: 1, 1: 0, 2: 0, 3: 22, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!