ID: 1127871532_1127871537

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1127871532 1127871537
Species Human (GRCh38) Human (GRCh38)
Location 15:63078006-63078028 15:63078031-63078053
Sequence CCACCAGGGAGGTCTGAAGGAGC TTGGTTTCTGGTAAAGCAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!