ID: 1127900268_1127900272

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1127900268 1127900272
Species Human (GRCh38) Human (GRCh38)
Location 15:63335951-63335973 15:63335964-63335986
Sequence CCGCACTTGCTGCCTGTGTCTTT CTGTGTCTTTGGGAAGTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 428} {0: 1, 1: 0, 2: 2, 3: 40, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!