ID: 1127923595_1127923597

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1127923595 1127923597
Species Human (GRCh38) Human (GRCh38)
Location 15:63515850-63515872 15:63515866-63515888
Sequence CCACTCTCAGTCCTGCTGTCCAC TGTCCACAGACAATCTCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 448} {0: 1, 1: 0, 2: 3, 3: 14, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!