ID: 1128032879_1128032886

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1128032879 1128032886
Species Human (GRCh38) Human (GRCh38)
Location 15:64497404-64497426 15:64497449-64497471
Sequence CCTTTGCTCTTCTACTGTGACAT GTTCTTTGACATTGCTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 226} {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!