ID: 1128055907_1128055913

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1128055907 1128055913
Species Human (GRCh38) Human (GRCh38)
Location 15:64700035-64700057 15:64700060-64700082
Sequence CCCAGGCCAAGTGGAGGAGCCTG CCAAGGCCTAGCTCCTACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 273} {0: 1, 1: 0, 2: 0, 3: 19, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!