ID: 1128075122_1128075131

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1128075122 1128075131
Species Human (GRCh38) Human (GRCh38)
Location 15:64821077-64821099 15:64821097-64821119
Sequence CCAGCTCTTGGACTGGTGGGGGC GGCAGGGTGGGGGTGGGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 139} {0: 1, 1: 2, 2: 19, 3: 194, 4: 1384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!