ID: 1128103941_1128103946

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1128103941 1128103946
Species Human (GRCh38) Human (GRCh38)
Location 15:65029348-65029370 15:65029365-65029387
Sequence CCGGGCGCGGCCTGGAGGCCTTC GCCTTCAGCGGCCGGGTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163} {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!