ID: 1128109536_1128109550

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1128109536 1128109550
Species Human (GRCh38) Human (GRCh38)
Location 15:65067891-65067913 15:65067936-65067958
Sequence CCCGCCCGTCGGGGCCCAGGGGA GCGCGCGGCCCCGGACCCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 156} {0: 1, 1: 0, 2: 1, 3: 10, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!