ID: 1128160521_1128160526

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1128160521 1128160526
Species Human (GRCh38) Human (GRCh38)
Location 15:65420746-65420768 15:65420790-65420812
Sequence CCATCATCATTCTCCTTCTACAG TACTACTCATCACTTTCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 489} {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!