ID: 1128161031_1128161043

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1128161031 1128161043
Species Human (GRCh38) Human (GRCh38)
Location 15:65422950-65422972 15:65422970-65422992
Sequence CCCGGGGAGGCGCGGCGCCGCGG CGGGCGGGGGCGCGGCCTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 326} {0: 1, 1: 1, 2: 14, 3: 69, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!