ID: 1128161033_1128161046

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1128161033 1128161046
Species Human (GRCh38) Human (GRCh38)
Location 15:65422951-65422973 15:65422977-65422999
Sequence CCGGGGAGGCGCGGCGCCGCGGG GGGCGCGGCCTCGGGGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 45, 4: 342} {0: 1, 1: 0, 2: 6, 3: 67, 4: 635}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!