ID: 1128208121_1128208136

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1128208121 1128208136
Species Human (GRCh38) Human (GRCh38)
Location 15:65870317-65870339 15:65870357-65870379
Sequence CCCTCCCCAAATCGTGTTTAGAG CGACCTGGGTGGTGGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70} {0: 1, 1: 0, 2: 0, 3: 54, 4: 535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!