ID: 1128254039_1128254048

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1128254039 1128254048
Species Human (GRCh38) Human (GRCh38)
Location 15:66184368-66184390 15:66184388-66184410
Sequence CCATCCCCCTCCCTCTTCCACAG CAGCTCCCACCATCTCACCTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 207, 4: 1745} {0: 1, 1: 0, 2: 3, 3: 18, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!