ID: 1128313561_1128313571

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1128313561 1128313571
Species Human (GRCh38) Human (GRCh38)
Location 15:66646417-66646439 15:66646451-66646473
Sequence CCCGAGACTTTGAGGAAGGTCCC GTCAGTGCGTGGGCTGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 1302} {0: 1, 1: 0, 2: 1, 3: 17, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!