ID: 1128314993_1128315009

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1128314993 1128315009
Species Human (GRCh38) Human (GRCh38)
Location 15:66654781-66654803 15:66654813-66654835
Sequence CCCTGCCCTCCCCAAACTGGAGC GGGACAAAGGAGGGGGCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 438} {0: 1, 1: 0, 2: 3, 3: 33, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!