ID: 1128323007_1128323025

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1128323007 1128323025
Species Human (GRCh38) Human (GRCh38)
Location 15:66705734-66705756 15:66705780-66705802
Sequence CCCTCAAGAAACATAATCCCACC GGGAAGAAGGGAAGTGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151} {0: 1, 1: 0, 2: 3, 3: 94, 4: 913}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!