ID: 1128367857_1128367860

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1128367857 1128367860
Species Human (GRCh38) Human (GRCh38)
Location 15:67017379-67017401 15:67017396-67017418
Sequence CCATCTCCAAAAAAAAGAAAAAA AAAAAAGAAAAGATGCAGCTGGG
Strand - +
Off-target summary {0: 41, 1: 3835, 2: 90591, 3: 74982, 4: 148093} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!