ID: 1128482992_1128483003

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1128482992 1128483003
Species Human (GRCh38) Human (GRCh38)
Location 15:68055143-68055165 15:68055189-68055211
Sequence CCTTCTTTTGCCTTAGCTGGTGT GGTCTCTGCACACACCATGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 59, 4: 1073} {0: 1, 1: 0, 2: 1, 3: 10, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!