ID: 1128521842_1128521852

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1128521842 1128521852
Species Human (GRCh38) Human (GRCh38)
Location 15:68380546-68380568 15:68380588-68380610
Sequence CCAGGTGTGGCAGGGCACAGAGG TCTGGGGAGCCTTCCTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 89, 4: 658} {0: 1, 1: 0, 2: 6, 3: 50, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!