ID: 1128562081_1128562089

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1128562081 1128562089
Species Human (GRCh38) Human (GRCh38)
Location 15:68675362-68675384 15:68675398-68675420
Sequence CCTTTGGAGCTGTCTCTTCCTCT AGGGAAAGTAAAGCCTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 400} {0: 1, 1: 0, 2: 0, 3: 21, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!