ID: 1128608981_1128608988

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1128608981 1128608988
Species Human (GRCh38) Human (GRCh38)
Location 15:69058794-69058816 15:69058819-69058841
Sequence CCCCTCTTCATCAGGCTTGGGAA CTTGGACAAAACGCTCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 133} {0: 1, 1: 0, 2: 0, 3: 4, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!