ID: 1128627479_1128627483

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1128627479 1128627483
Species Human (GRCh38) Human (GRCh38)
Location 15:69224658-69224680 15:69224690-69224712
Sequence CCTGCAAGCTGAGTACAAACTGC ACATGCACAGCTGCCTGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 131} {0: 4, 1: 8, 2: 17, 3: 54, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!