ID: 1128654768_1128654771

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1128654768 1128654771
Species Human (GRCh38) Human (GRCh38)
Location 15:69452702-69452724 15:69452720-69452742
Sequence CCAATCAGGCGCAGTGCGCAGGC CAGGCGCCTTCAGTGGGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 78} {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!