ID: 1128866620_1128866623

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1128866620 1128866623
Species Human (GRCh38) Human (GRCh38)
Location 15:71119443-71119465 15:71119459-71119481
Sequence CCACTTTATCCCAGGCAGCATGT AGCATGTTCCTTTTTGACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 205} {0: 1, 1: 0, 2: 0, 3: 10, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!