ID: 1128874666_1128874671

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1128874666 1128874671
Species Human (GRCh38) Human (GRCh38)
Location 15:71192364-71192386 15:71192391-71192413
Sequence CCTCCACCTCCCAGGTTCAAGTG TCTTGCCTCAAGTACCCGAGTGG
Strand - +
Off-target summary {0: 6203, 1: 24732, 2: 65365, 3: 109290, 4: 136894} {0: 1, 1: 0, 2: 0, 3: 16, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!