|
Left Crispr |
Right Crispr |
Crispr ID |
1128874937 |
1128874940 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:71194123-71194145
|
15:71194161-71194183
|
Sequence |
CCAGCCACGTGGTACTGTGAGTC |
TCTTCATAAATTCCCAGTCTCGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 591, 2: 4655, 3: 7724, 4: 8129} |
{0: 2, 1: 2, 2: 32, 3: 95, 4: 344} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|