ID: 1128874937_1128874940

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1128874937 1128874940
Species Human (GRCh38) Human (GRCh38)
Location 15:71194123-71194145 15:71194161-71194183
Sequence CCAGCCACGTGGTACTGTGAGTC TCTTCATAAATTCCCAGTCTCGG
Strand - +
Off-target summary {0: 3, 1: 591, 2: 4655, 3: 7724, 4: 8129} {0: 2, 1: 2, 2: 32, 3: 95, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!