ID: 1128915012_1128915019

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1128915012 1128915019
Species Human (GRCh38) Human (GRCh38)
Location 15:71551901-71551923 15:71551937-71551959
Sequence CCAGTTCTGGGAATGATGGGAAC AAGTTACCAGATGCCAGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 24, 4: 201} {0: 1, 1: 1, 2: 24, 3: 107, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!