ID: 1128925454_1128925457

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1128925454 1128925457
Species Human (GRCh38) Human (GRCh38)
Location 15:71651209-71651231 15:71651228-71651250
Sequence CCATCTTCAGTCCAGTTGGCCAT CCATTCCTTCAGCGTGATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130} {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!