ID: 1128943804_1128943809

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1128943804 1128943809
Species Human (GRCh38) Human (GRCh38)
Location 15:71808561-71808583 15:71808579-71808601
Sequence CCGTGTTCCAGAAGAGATGGGAA GGGAAAGAGCGGCTTCGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 298} {0: 1, 1: 0, 2: 1, 3: 14, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!