ID: 1128946591_1128946596

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1128946591 1128946596
Species Human (GRCh38) Human (GRCh38)
Location 15:71827082-71827104 15:71827121-71827143
Sequence CCCTCTAAAGCAAATCATCATAT TGTTCACACATGAAATTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 241} {0: 1, 1: 0, 2: 3, 3: 24, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!