ID: 1128966130_1128966136

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1128966130 1128966136
Species Human (GRCh38) Human (GRCh38)
Location 15:72060495-72060517 15:72060532-72060554
Sequence CCATGTTGTCCAGAGACAGAATC AGAGATAGCACAGAGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 232} {0: 1, 1: 0, 2: 8, 3: 78, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!