ID: 1128973754_1128973757

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1128973754 1128973757
Species Human (GRCh38) Human (GRCh38)
Location 15:72132813-72132835 15:72132826-72132848
Sequence CCTCCACATTCCTACTATCATTT ACTATCATTTCTCCTGCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 274} {0: 1, 1: 0, 2: 1, 3: 19, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!