ID: 1128985683_1128985687

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1128985683 1128985687
Species Human (GRCh38) Human (GRCh38)
Location 15:72219240-72219262 15:72219264-72219286
Sequence CCAGACATGATCTGGTTATGTGG TGCTCCTCATGTTAGAAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104} {0: 1, 1: 0, 2: 0, 3: 25, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!