ID: 1129106256_1129106263

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1129106256 1129106263
Species Human (GRCh38) Human (GRCh38)
Location 15:73309342-73309364 15:73309356-73309378
Sequence CCCCCAGATTCCTGGAACACTGC GAACACTGCAAGGGCAATACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!