ID: 1129109105_1129109109

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1129109105 1129109109
Species Human (GRCh38) Human (GRCh38)
Location 15:73327490-73327512 15:73327506-73327528
Sequence CCACTCACATGCTGAGCCCCACC CCCCACCCCAGTCACAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 295} {0: 2, 1: 0, 2: 3, 3: 42, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!