ID: 1129109293_1129109301

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1129109293 1129109301
Species Human (GRCh38) Human (GRCh38)
Location 15:73328339-73328361 15:73328378-73328400
Sequence CCCAGGGCAGGAGCTGAGCATGA ATGCTCCTCAAATGCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 302} {0: 1, 1: 0, 2: 3, 3: 37, 4: 907}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!