ID: 1129115105_1129115114

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1129115105 1129115114
Species Human (GRCh38) Human (GRCh38)
Location 15:73361256-73361278 15:73361297-73361319
Sequence CCCACCTCAGATCCGAGTGGGTG CCAGTGGCTTCCTAGCCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111} {0: 1, 1: 0, 2: 1, 3: 35, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!