ID: 1129116750_1129116758

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1129116750 1129116758
Species Human (GRCh38) Human (GRCh38)
Location 15:73368896-73368918 15:73368924-73368946
Sequence CCGCGCCCCGGAATATTCATGAA CGCAGCTCGCGGGTTGCCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54} {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!